Creative Commons License
This blog by Tommy Tang is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

My github papge

Showing posts with label fastqc. Show all posts
Showing posts with label fastqc. Show all posts

Friday, July 25, 2014

run a local blast

I was checking the quality of a ChIP-seq fastq with fastqc, and the overrepresented sequence showed that the data contain Illumina Single End Adapter 1 contamination.

I have a file which contains all the possible illumina library sequences in fasta format (got from here), and I manually looked it and found that the single End Adapter 1 sequence did not match the report. I then was wondering  which sequence is the contamination. To do that, I have to do a local blast of  the overrepresented sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGATCGGAAGAGCTCGTATGCC"
on the illumina library sequences.

Luckily, the ncbi_blast was installed on the HPC. One can follow the link here run local blast
first, use the formatdb command to convert the file to a database

$ module load ncbi_blast

# check what arguments are for the command
$ formatdb -

formatdb 2.2.26   arguments:

  -t  Title for database file [String]  Optional
  -i  Input file(s) for formatting [File In]  Optional
  -l  Logfile name: [File Out]  Optional
    default = formatdb.log
  -p  Type of file
         T - protein
         F - nucleotide [T/F]  Optional
    default = T
  -o  Parse options
         T - True: Parse SeqId and create indexes.
         F - False: Do not parse SeqId. Do not create indexes.
 [T/F]  Optional
    default = F
  -a  Input file is database in ASN.1 format (otherwise FASTA is expected)
         T - True,
         F - False.
 [T/F]  Optional
    default = F
  -b  ASN.1 database in binary mode
         T - binary,
         F - text mode.
 [T/F]  Optional
    default = F
  -e  Input is a Seq-entry [T/F]  Optional
    default = F
  -n  Base name for BLAST files [String]  Optional
  -v  Database volume size in millions of letters [Integer]  Optional
    default = 4000
  -s  Create indexes limited only to accessions - sparse [T/F]  Optional
    default = F
  -V  Verbose: check for non-unique string ids in the database [T/F]  Optional
    default = F
  -L  Create an alias file with this name
        use the gifile arg (below) if set to calculate db size
        use the BLAST db specified with -i (above) [File Out]  Optional
  -F  Gifile (file containing list of gi's) [File In]  Optional
  -B  Binary Gifile produced from the Gifile specified above [File Out]  Optional
  -T  Taxid file to set the taxonomy ids in ASN.1 deflines [File In]  Optional


$ formatdb -i adaptors_list.fa -o F -p F

several other files with names ended with nhr, nin and nsq are generated in the same directory.
then run blast:

# check argument for balstall
$ blastall -
blastall 2.2.26   arguments:

  -p  Program Name [String]
  -d  Database [String]
    default = nr
  -i  Query File [File In]
    default = stdin
  -e  Expectation value (E) [Real]
    default = 10.0
  -m  alignment view options:
0 = pairwise,
1 = query-anchored showing identities,
2 = query-anchored no identities,
3 = flat query-anchored, show identities,
4 = flat query-anchored, no identities,
5 = query-anchored no identities and blunt ends,
6 = flat query-anchored, no identities and blunt ends,
7 = XML Blast output,
8 = tabular,
9 tabular with comment lines
10 ASN, text
11 ASN, binary [Integer]
    default = 0
    range from 0 to 11
  -o  BLAST report Output File [File Out]  Optional
    default = stdout
  -F  Filter query sequence (DUST with blastn, SEG with others) [String]
    default = T
  -G  Cost to open a gap (-1 invokes default behavior) [Integer]
    default = -1
  -E  Cost to extend a gap (-1 invokes default behavior) [Integer]
    default = -1
  -X  X dropoff value for gapped alignment (in bits) (zero invokes default behavior)
      blastn 30, megablast 20, tblastx 0, all others 15 [Integer]
    default = 0
  -I  Show GI's in deflines [T/F]
    default = F
  -q  Penalty for a nucleotide mismatch (blastn only) [Integer]
    default = -3
  -r  Reward for a nucleotide match (blastn only) [Integer]
    default = 1
  -v  Number of database sequences to show one-line descriptions for (V) [Integer]
    default = 500
  -b  Number of database sequence to show alignments for (B) [Integer]
    default = 250
  -f  Threshold for extending hits, default if zero
      blastp 11, blastn 0, blastx 12, tblastn 13
      tblastx 13, megablast 0 [Real]
    default = 0
  -g  Perform gapped alignment (not available with tblastx) [T/F]
    default = T
  -Q  Query Genetic code to use [Integer]
    default = 1
  -D  DB Genetic code (for tblast[nx] only) [Integer]
    default = 1
  -a  Number of processors to use [Integer]
    default = 1
  -O  SeqAlign file [File Out]  Optional
  -J  Believe the query defline [T/F]
    default = F
  -M  Matrix [String]
    default = BLOSUM62
..........
..........

$ blastall -i overrepresented_sequence.fa -d adaptors_list.fa -p blastn -e 1e-6 

look at the result, I found that Adapter 2 is the contamination 
>Illumina_Single_End_Apapter_2
          Length = 34

 Score = 63.9 bits (32), Expect = 1e-14
 Identities = 32/32 (100%)
 Strand = Plus / Minus


Query: 1  gatcggaagagctcgtatgccgtcttctgctt 32
          ||||||||||||||||||||||||||||||||
Sbjct: 33 gatcggaagagctcgtatgccgtcttctgctt 2


I then feed Trimmomatic with this fasta file and removed the adaptor.



Thursday, June 26, 2014

quality control of your fastq file! my first post after I got my PhD!

I passed my defense on Tuesday, and now I am a PhD! what a long process, it took me six years. I've been enjoying the PhD experience though.

OK, let me go back to this post. things to remember:
1) You must quality control your fastq files first by fastqc. Trim the adapters and low quality bases by trimmomatic.
2) The fastq files dumped from the SRA GEO repository are usually the raw sequence, you need to quality control them.
3) google, google before you ask anyone else!

Let's start.
inspecting the first several reads of the fastq (this is a ChIP-seq data), I found the quality is coded as phred33

@SRR866627_nutlin_p53.1 HWI-ST571:161:D0YP4ACXX:3:1101:1437:2055 length=51
NCGAAAGACTGCTGGCCGACGTCGAGGTCCCGATTGTCGGCGTCGGCGGCA
+SRR866627_nutlin_p53.1 HWI-ST571:161:D0YP4ACXX:3:1101:1437:2055 length=51
#1:AABDDH<?CF<CFHH@D:??FAEE6?FHDAA=@CF@4@EBA88@;575
@SRR866627_nutlin_p53.2 HWI-ST571:161:D0YP4ACXX:3:1101:1423:2163 length=51
GAAATACTGTCTCTACTAAAAATACAAAAAGTAGCCAGGCGTCGTGGTGCA
+SRR866627_nutlin_p53.2 HWI-ST571:161:D0YP4ACXX:3:1101:1423:2163 length=51
B@CFFFFFHHHHGIJJJJIJJJIJJJJIJJIEGHIJJJJIJIIIHIE=FGC

To know different quality coding see here:
  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS.....................................................
  ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......................
  ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................
  .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ......................
  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL....................................................
  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
  |                         |    |        |                              |                     |
 33                        59   64       73                            104                   126
  0........................26...31.......40                                
                           -5....0........9.............................40 
                                 0........9.............................40 
                                    3.....9.............................40 
  0.2......................26...31.........41                              

 S - Sanger        Phred+33,  raw reads typically (0, 40)
 X - Solexa        Solexa+64, raw reads typically (-5, 40)
 I - Illumina 1.3+ Phred+64,  raw reads typically (0, 40)
 J - Illumina 1.5+ Phred+64,  raw reads typically (3, 40)
     with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) 
     (Note: See discussion above).
 L - Illumina 1.8+ Phred+33,  raw reads typically (0, 41)

then I used fastqc to check the quality:





the quality for each base is very good, but the perbase sequence content does not look good, and the adapters are not trimmed as indicated by the overrepresented sequences (highlighted part is part of the Truseq adapter index1).

Then I used Trimmomatic to trim the adapters and the low quality bases.
$ trimmomatic SE  in.fastq in_trimmed.fastq ILLUMINACLIP:Truseq_adaptor.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

the Truseq_adaptor.fa file contains the adapter sequences. see a post here.

$ cat Truseq_adaptor.fa
>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Adapter_Index_1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_3
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_4
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_5
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_6
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_7
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_8
GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_9
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_10
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_11
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_12
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG
after that, I checked the with fastqc again:


The perbase quality was improved and the per base GC content became more normal (should be 25% percent for each A,T,C,G base, it looks like the sequences are more A/T rich). More importantly, no overrepresent sequences were found anymore. Now the fastq file is ready for subsequent mapping by bowtie.

sometime ago, I quality controlled a RNA-seq data, and found found many wired things and asked on biostar.





Take home messages:
1)
"The weird per-base content is extremely normal and is typically referred to as the "random" hexamer effect, since things aren't actually amplified in a uniform manner. Most people will have this and it's nothing to worry about. BTW, don't let anyone talk you into trimming that off, it's the legitimate sequence."

2)
"Duplicates are expected in RNAseq. Firstly, your samples are probably full of rRNAs, even if you performed ribodepletion. Secondly, any highly expressed gene is going to have apparent PCR duplication due solely to it being highly expressed (there is a ceiling on the coverage you can get before running into this, it's pretty high with paired-end reads but not infinite)."

3)Several posts for whether the duplicates need to be removed or not.
https://www.biostars.org/p/55648/
https://www.biostars.org/p/66831/
https://www.biostars.org/p/14283/

Currently, I do not remove them. That's all for today!