Friday, July 25, 2014

run a local blast

I was checking the quality of a ChIP-seq fastq with fastqc, and the overrepresented sequence showed that the data contain Illumina Single End Adapter 1 contamination.

I have a file which contains all the possible illumina library sequences in fasta format (got from here), and I manually looked it and found that the single End Adapter 1 sequence did not match the report. I then was wondering  which sequence is the contamination. To do that, I have to do a local blast of  the overrepresented sequence "GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGATCGGAAGAGCTCGTATGCC"
on the illumina library sequences.

Luckily, the ncbi_blast was installed on the HPC. One can follow the link here run local blast
first, use the formatdb command to convert the file to a database

$ module load ncbi_blast

# check what arguments are for the command
$ formatdb -

formatdb 2.2.26   arguments:

  -t  Title for database file [String]  Optional
  -i  Input file(s) for formatting [File In]  Optional
  -l  Logfile name: [File Out]  Optional
    default = formatdb.log
  -p  Type of file
         T - protein
         F - nucleotide [T/F]  Optional
    default = T
  -o  Parse options
         T - True: Parse SeqId and create indexes.
         F - False: Do not parse SeqId. Do not create indexes.
 [T/F]  Optional
    default = F
  -a  Input file is database in ASN.1 format (otherwise FASTA is expected)
         T - True,
         F - False.
 [T/F]  Optional
    default = F
  -b  ASN.1 database in binary mode
         T - binary,
         F - text mode.
 [T/F]  Optional
    default = F
  -e  Input is a Seq-entry [T/F]  Optional
    default = F
  -n  Base name for BLAST files [String]  Optional
  -v  Database volume size in millions of letters [Integer]  Optional
    default = 4000
  -s  Create indexes limited only to accessions - sparse [T/F]  Optional
    default = F
  -V  Verbose: check for non-unique string ids in the database [T/F]  Optional
    default = F
  -L  Create an alias file with this name
        use the gifile arg (below) if set to calculate db size
        use the BLAST db specified with -i (above) [File Out]  Optional
  -F  Gifile (file containing list of gi's) [File In]  Optional
  -B  Binary Gifile produced from the Gifile specified above [File Out]  Optional
  -T  Taxid file to set the taxonomy ids in ASN.1 deflines [File In]  Optional


$ formatdb -i adaptors_list.fa -o F -p F

several other files with names ended with nhr, nin and nsq are generated in the same directory.
then run blast:

# check argument for balstall
$ blastall -
blastall 2.2.26   arguments:

  -p  Program Name [String]
  -d  Database [String]
    default = nr
  -i  Query File [File In]
    default = stdin
  -e  Expectation value (E) [Real]
    default = 10.0
  -m  alignment view options:
0 = pairwise,
1 = query-anchored showing identities,
2 = query-anchored no identities,
3 = flat query-anchored, show identities,
4 = flat query-anchored, no identities,
5 = query-anchored no identities and blunt ends,
6 = flat query-anchored, no identities and blunt ends,
7 = XML Blast output,
8 = tabular,
9 tabular with comment lines
10 ASN, text
11 ASN, binary [Integer]
    default = 0
    range from 0 to 11
  -o  BLAST report Output File [File Out]  Optional
    default = stdout
  -F  Filter query sequence (DUST with blastn, SEG with others) [String]
    default = T
  -G  Cost to open a gap (-1 invokes default behavior) [Integer]
    default = -1
  -E  Cost to extend a gap (-1 invokes default behavior) [Integer]
    default = -1
  -X  X dropoff value for gapped alignment (in bits) (zero invokes default behavior)
      blastn 30, megablast 20, tblastx 0, all others 15 [Integer]
    default = 0
  -I  Show GI's in deflines [T/F]
    default = F
  -q  Penalty for a nucleotide mismatch (blastn only) [Integer]
    default = -3
  -r  Reward for a nucleotide match (blastn only) [Integer]
    default = 1
  -v  Number of database sequences to show one-line descriptions for (V) [Integer]
    default = 500
  -b  Number of database sequence to show alignments for (B) [Integer]
    default = 250
  -f  Threshold for extending hits, default if zero
      blastp 11, blastn 0, blastx 12, tblastn 13
      tblastx 13, megablast 0 [Real]
    default = 0
  -g  Perform gapped alignment (not available with tblastx) [T/F]
    default = T
  -Q  Query Genetic code to use [Integer]
    default = 1
  -D  DB Genetic code (for tblast[nx] only) [Integer]
    default = 1
  -a  Number of processors to use [Integer]
    default = 1
  -O  SeqAlign file [File Out]  Optional
  -J  Believe the query defline [T/F]
    default = F
  -M  Matrix [String]
    default = BLOSUM62
..........
..........

$ blastall -i overrepresented_sequence.fa -d adaptors_list.fa -p blastn -e 1e-6 

look at the result, I found that Adapter 2 is the contamination 
>Illumina_Single_End_Apapter_2
          Length = 34

 Score = 63.9 bits (32), Expect = 1e-14
 Identities = 32/32 (100%)
 Strand = Plus / Minus


Query: 1  gatcggaagagctcgtatgccgtcttctgctt 32
          ||||||||||||||||||||||||||||||||
Sbjct: 33 gatcggaagagctcgtatgccgtcttctgctt 2


I then feed Trimmomatic with this fasta file and removed the adaptor.



No comments:

Post a Comment